|
Qinhuangdao Lihua Starch Co Ltd
single-stranded dna library of aptamers Single Stranded Dna Library Of Aptamers, supplied by Qinhuangdao Lihua Starch Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single-stranded dna library of aptamers/product/Qinhuangdao Lihua Starch Co Ltd Average 90 stars, based on 1 article reviews
single-stranded dna library of aptamers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
SomaLogic
multiplexed aptamer-based platform Multiplexed Aptamer Based Platform, supplied by SomaLogic, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiplexed aptamer-based platform/product/SomaLogic Average 90 stars, based on 1 article reviews
multiplexed aptamer-based platform - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
38-mer single-strand dna aptamers for pcb-77 38 Mer Single Strand Dna Aptamers For Pcb 77, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/38-mer single-strand dna aptamers for pcb-77/product/Sangon Biotech Average 90 stars, based on 1 article reviews
38-mer single-strand dna aptamers for pcb-77 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Navien INC
novel single-stranded dna aptamers Novel Single Stranded Dna Aptamers, supplied by Navien INC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/novel single-stranded dna aptamers/product/Navien INC Average 90 stars, based on 1 article reviews
novel single-stranded dna aptamers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Nexmos Inc
single-stranded dna (ssdna) aptamer ![]() Single Stranded Dna (Ssdna) Aptamer, supplied by Nexmos Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single-stranded dna (ssdna) aptamer/product/Nexmos Inc Average 90 stars, based on 1 article reviews
single-stranded dna (ssdna) aptamer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
SomaLogic
5284 somamer single-stranded dna aptamers ![]() 5284 Somamer Single Stranded Dna Aptamers, supplied by SomaLogic, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5284 somamer single-stranded dna aptamers/product/SomaLogic Average 90 stars, based on 1 article reviews
5284 somamer single-stranded dna aptamers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Metabion International AG
32-nucleotide single-stranded dna aptamer probe e1 ![]() 32 Nucleotide Single Stranded Dna Aptamer Probe E1, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/32-nucleotide single-stranded dna aptamer probe e1/product/Metabion International AG Average 90 stars, based on 1 article reviews
32-nucleotide single-stranded dna aptamer probe e1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
SomaLogic
the somascan® platform for proteomics profiling uses 4979 somamer® reagents, single-stranded dna aptamers, to 4776 unique human protein targets Figure S4 . " width="250" height="auto" />The Somascan® Platform For Proteomics Profiling Uses 4979 Somamer® Reagents, Single Stranded Dna Aptamers, To 4776 Unique Human Protein Targets, supplied by SomaLogic, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/the somascan® platform for proteomics profiling uses 4979 somamer® reagents, single-stranded dna aptamers, to 4776 unique human protein targets/product/SomaLogic Average 90 stars, based on 1 article reviews
the somascan® platform for proteomics profiling uses 4979 somamer® reagents, single-stranded dna aptamers, to 4776 unique human protein targets - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer) Figure S4 . " width="250" height="auto" />Str Binding Single Stranded Dna (Str1 Aptamer Sequence: 50 Tagggaattcgtcgacggatccggggtctggtgttctgctttg Ttctgtcgggtcgtctgcaggtcgacgcatgcgccg 30, 79 Mer), supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer)/product/Sangon Biotech Average 90 stars, based on 1 article reviews
str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
PCL Inc
cy3-labeled single-stranded dna aptamer Figure S4 . " width="250" height="auto" />Cy3 Labeled Single Stranded Dna Aptamer, supplied by PCL Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cy3-labeled single-stranded dna aptamer/product/PCL Inc Average 90 stars, based on 1 article reviews
cy3-labeled single-stranded dna aptamer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
single-stranded (ss) dna aptamer library and primers Figure S4 . " width="250" height="auto" />Single Stranded (Ss) Dna Aptamer Library And Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single-stranded (ss) dna aptamer library and primers/product/Sangon Biotech Average 90 stars, based on 1 article reviews
single-stranded (ss) dna aptamer library and primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
complementary single strand dna kanamycin aptamer Figure S4 . " width="250" height="auto" />Complementary Single Strand Dna Kanamycin Aptamer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/complementary single strand dna kanamycin aptamer/product/Sangon Biotech Average 90 stars, based on 1 article reviews
complementary single strand dna kanamycin aptamer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Pharmaceuticals
Article Title: Anti-Inflammatory Effects of Aptamin C in Pulmonary Fibrosis Induced by Bleomycin
doi: 10.3390/ph17121577
Figure Lengend Snippet: Protective effect of Aptamin C on bleomycin-induced mortality in mice. Survival rates were measured in mice ( n = 8) subjected to intratracheal injection of bleomycin (1.5 mg/kg) or PBS alone (negative control (NCTL)) in a 30 μL total volume. The mice were intraperitoneally administered with PBS containing 1 mM of MgCl 2 (Vehicle; Control (CTL)), 100 mg/kg vitamin C, 2 mg/kg aptamer, or a combination of vitamin C (100 mg/kg) and aptamer (2 mg/kg; Aptamin C). ( A ) Body weight change was recorded three times per week. ( B ) Mortality was monitored daily for 38 days and the percent survival rate was expressed as Kaplan–Meier survival plots. The survival plots were analyzed using a log-rank (Mantel–Cox) test. * p < 0.05 compared to the control.
Article Snippet: A single-stranded
Techniques: Injection, Negative Control, Control
Journal: Pharmaceuticals
Article Title: Anti-Inflammatory Effects of Aptamin C in Pulmonary Fibrosis Induced by Bleomycin
doi: 10.3390/ph17121577
Figure Lengend Snippet: Reduced infiltration of inflammatory cells in the lungs of Aptamin C-treated mice. Gulo KO mice ( n = 5) injected with bleomycin intraperitoneally were administered PBS containing 1 mM of MgCl 2 (Vehicle; Control (CTL)), 100 mg/kg vitamin C, 2 mg/kg aptamer, or a combination of Vitamin C (100 mg/kg) and aptamer (2 mg/kg; Aptamin C) for 14 days. BALF was obtained by intratracheal injection of 0.8 mL PBS, followed by withdrawal twice. ( A ) The total number of BALF cells was measured using a hemocytometer following staining with trypan blue. Data are presented as the mean ± SEM. * p < 0.05, *** p < 0.001. ( B ) Representative images are shown from Wright–Giemsa stained immune cells in BALF. Photomicrographs were captured at 200× and 400× magnification (scale bar = 150 and 300 µm, respectively). Negative control, NCTL.
Article Snippet: A single-stranded
Techniques: Injection, Control, Staining, Negative Control
Journal: Pharmaceuticals
Article Title: Anti-Inflammatory Effects of Aptamin C in Pulmonary Fibrosis Induced by Bleomycin
doi: 10.3390/ph17121577
Figure Lengend Snippet: Protective effect of Aptamin C on bleomycin-induced pulmonary fibrosis. Gulo KO mice ( n = 5) were treated with vehicle, vitamin C, aptamer, and Aptamin C for 14 days after bleomycin instillation. The mice were sacrificed, and lung tissue excised. The lung tissue sections were prepared and stained with ( A ) hematoxylin and eosin (H&E) staining and ( B ) Masson’s trichome staining. Photomicrographs were captured at 200× magnification (Scale bar = 150 µm). ( C ) The lung tissues index (tissue weight/body weight) was calculated. ( D ) The severity of lung fibrosis was assessed using the Ashcroft score based on H&E staining. ( E ) Collagen-positive areas (stained blue) based on Masson’s trichrome staining were quantified using Celleste™ image analysis software. A one-way ANOVA with Tukey’s multiple comparisons test was performed. * p < 0.05, ** p < 0.01, *** p < 0.001, ns: not significant. Negative control, NCTL; Control, CTL.
Article Snippet: A single-stranded
Techniques: Staining, Software, Negative Control, Control
Figure S4 . " width="100%" height="100%">
Journal: Cell
Article Title: Vascular Disease and Thrombosis in SARS-CoV-2-Infected Rhesus Macaques
doi: 10.1016/j.cell.2020.10.005
Figure Lengend Snippet: Interferon and Inflammatory Pathways Increased by SARS-CoV-2 in BAL and Peripheral Blood of Infected Macaques (A) Circles plot representation of the GSEA NES of interferon and inflammatory pathways (GSEA: FDR ≤ 5%) increased or decreased by SARS-CoV-2 in BAL (left panel) and in peripheral blood (right panel) on days 1, 2, 4, 7, 10, and 14 compared to control animals. An NES greater than 0 (in red) corresponds to a pathway for which member genes are increased by SARS-CoV-2, and an NES below 0 (in blue) corresponds to a pathway for which member genes are decreased by SARS-CoV-2. The size and color of each circle is proportional to the NES, where color gradient ranging from blue (significantly decreased), gray (not significant: FDR ≥ 5%), or red (significantly increased). (B and C) Heatmaps of the log2 transformed fold change of interferon and inflammatory markers in BAL (B) and in peripheral blood (C) that are increased or decreased by SARS-CoV-2 on days 1, 2, 4, 7, 10, and 14 compared to baseline. Differential expression significance was assessed with a corrected p < 0.05 using Benjamini-Hochberg (BH) method. (D) Heatmaps of log2 transformed fold change expression in serum (proteomics) of interferon genes, increased (in red gradient), decreased (in blue gradient), and white (not significant), on days 1, 2, 4, 10, and 14 compared to baseline. Differential expression significance was assessed with a corrected p < 0.05 using BH method. (E and F) IHC shows increase of MX1 and pSTAT3 on day 2 or day 4 following SARS-CoV-2 challenge. Serial sections of lung tissue showed increased expression of MX1 (type 1 interferon response gene) (E) and phosphorylated STAT3 (Phospho-STAT3 (F). Scale bars, 100 μm. See also
Article Snippet: The SomaScan® Platform for
Techniques: Infection, Transformation Assay, Expressing
Journal: Cell
Article Title: Vascular Disease and Thrombosis in SARS-CoV-2-Infected Rhesus Macaques
doi: 10.1016/j.cell.2020.10.005
Figure Lengend Snippet: Cytokines and Chemokines Up- or Downregulated by SARS-CoV-2 in BAL, Peripheral Blood, and Serum of Infected Macaques (A and B) (Left panels) Heatmaps of log2 transformed fold change expression of individual cytokines increased (in red gradient), decreased (in blue gradient), or white (not significant) in BAL (A) and peripheral blood (B) on days 1, 2, 4, 7, 10, and 14 compared to baseline. (Right panels) Heatmaps of the GSEA NES of cytokines’ signaling pathways increased (in red gradient), decreased (in blue gradient), or white (not significant) in BAL (A) and peripheral blood (B) on days 1, 2, 4, 7, 10, and 14 compared to baseline. All individual cytokines were significant with a p < 0.05 for at least one time point post-challenge compared to baseline and all cytokines’ signaling pathways were significant with a GSEA nominal p < 0.05 for at least one time point post-challenge compared to baseline. Star symbol indicates individual cytokines or chemokines and pathways that remain significant after correction for multiple comparisons (BH method) or using a FDR of <5%. (C and D) Enrichment plot showing differentially expressed genes (DEGs) that contribute to the positive enrichment of the IL6-JAK-STAT3 signaling pathway on day 2 in BAL (C) and peripheral blood (D) of infected macaques. Plot of the running sum for pathway score in the dataset, including the location of the maximum ES and the leading-edge subset. The red plot shows the ES for the gene set as the analysis walks down the ranked list. The score at the peak of the plot (the score furthest from 0.0) is the ES for the gene set. The small black bars on the x axis show where the members of the gene set appear in the ranked list of genes. The leading-edge subset of a gene set is the subset of members that contribute most to the ES. The leading genes were shown for each plot. (E and F) IHC shows increased expression of IL-6 (E) and IL-10 (F) on day 2 or day 4 following SARS-CoV-2 challenge. Scale bars, 100 μm. (G) Heatmaps of log2 transformed fold change expression in serum (proteomics) of cytokines and chemokines increased (red gradient), decreased (blue gradient), and white (not significant), on days 1, 2, 4, 10, and 14 following challenge. Differential expression significance was assessed using a BH-corrected p < 0.05. (H) Cytokine levels measured by the Luminex assay in BAL (top panel) and in serum (lower panel) increased by SARS-CoV-2 in rhesus macaques on days 1, 2, 4, 7, 10, 14, or 35. All the cytokines and chemokines that are significant (Wilcoxon-Mann-Whitney test, p < 0.05) for at least one time point were shown on the heatmaps. Color gradient ranging from white (not significant) to red (highly significant) corresponds to the log2 transformation of the fold change of cytokines’ median levels compared to baseline. See also and .
Article Snippet: The SomaScan® Platform for
Techniques: Infection, Transformation Assay, Expressing, Luminex, MANN-WHITNEY